lastz_test.fa

lastz_test2.fa



Lastz 실행


/* 2017.8.13 by. 3months */


Lastz를 설치하였으면 간단하게 결과를 뽑아보자.


두 개의 fasta 파일을 폴더에 붙여넣고,


해당 폴더에서 아래 명령어를 입력해보자.



lastz lastz_test.fa lastz_test2.fa



결과

#:lav
d {
  "lastz.v1.04.00 lastz_test.fa lastz_test2.fa
     A    C    G    T
    91 -114  -31 -123
  -114  100 -125  -31
   -31 -125  100 -114
  -123  -31 -114   91
  O = 400, E = 30, K = 3000, L = 3000, M = 0"
}
#:lav
s {
  "lastz_test.fa" 1 511 0 1
  "lastz_test2.fa" 1 521 0 1
}
h {
   ">ref"
   ">ref"
}
a {
  s 47093
  b 1 1
  e 511 521
  l 1 1 194 194 100
  l 195 203 208 216 100
  l 209 221 371 383 100
  l 374 384 511 521 100
}
m {
  n 0
}
#:eof



그러면 콘솔창에 이런 결과가 나온다.



또는 아래와 같이 옵션을 주어서 실행하면 maf 파일로 내보낼 수 있다.


lastz lastz_test.fa lastz_test2.fa --format=maf > lastz_result.maf



lastz_result.maf 파일을 열어보면 아래와 같이 되어있다.  (이것이 무엇을 뜻하는지는 다음에 알아보자..)

##maf version=1 scoring=lastz.v1.04.00
# lastz.v1.04.00 --format=maf
#
# hsp_threshold      = 3000
# gapped_threshold   = 3000
# x_drop             = 910
# y_drop             = 9400
# gap_open_penalty   = 400
# gap_extend_penalty = 30
#        A    C    G    T
#   A   91 -114  -31 -123
#   C -114  100 -125  -31
#   G  -31 -125  100 -114
#   T -123  -31 -114   91


a score=47093
s ref 0 511 + 511 GAAGAGCAGCACACTCAGATCTTCTTACACCATCTCTGGGGGCCGACTGGCAGAGAAGGCTAGGGACTTGGCCAATATCATGCAGCCTTCATGCCTTATTCGGGAAAGGTGCTCCAAATAGGAGGAATATTTGGAAGAAATCCCAATAGGGATTTGGAGACATGCCATTTGGGAATGCAAACCCAGCCCCTCCT--------AGTGCTCCACCCTG----CCCATGTCCCCATTGAACCGACAACCTGCAGAGAGAGCAGGATGCCCACAGCAAGCCCCAAGGACAAAGGCCACAGAGTCAGGGCACCCAAATCCTAACCTAACCTTGCCTGTGCTTCCTGTGTACTGTGGCCATTTTACTTTCCCCCTGTTCCCTCCTCTGTAAATGAGGCCCTTGGACTGCATCAGTGGTTTTTACACTGAGCTCCCTGGAGCTCTGGGGGCCTCAGGGACTATTGTGGAGGCCTTGCTGCATTTGAGAGTGGTGTCTTGTACCCTACTCAACCCATTTTTTCTGTTTTAC

s ref 0 521 + 521 GAAGAGCAGCACACTCAGATCTTCTTACACCATCTCTGGGGGCCGACTGGCAGAGAAGGCTAGGGACTTGGCCAATATCATGCAGCCTTCATGCCTTATTCGGGAAAGGTGCTCCAAATAGGAGGAATATTTGGAAGAAATCCCAATAGGGATTTGGAGACATGCCATTTGGGAATGCAAACCCAGCCCCTCCTAGAGAGAGAGTGCTCCACCCTGCCCCCCCATGTCCCCATTGAACCGACAACCTGCAGAGAGAGCAGGATGCCCACAGCAAGCCCCAAGGACAAAGGCCACAGAGTCAGGGCACCCAAATCCTAACCTAACCTTGCCTGTGCTTCCTGTGTACTGTGGCCATTTTACTTTCCCCCTGTTCCCTCCTCTGT--ATGAGGCCCTTGGACTGCATCAGTGGTTTTTACACTGAGCTCCCTGGAGCTCTGGGGGCCTCAGGGACTATTGTGGAGGCCTTGCTGCATTTGAGAGTGGTGTCTTGTACCCTACTCAACCCATTTTTTCTGTTTTAC


아래 링크에서 lastz 실행과 관련된 다양한 예제를 볼 수 있다.

http://www.bx.psu.edu/miller_lab/dist/README.lastz-1.02.00/README.lastz-1.02.00a.html#examples




'Domains > Bioinformatics' 카테고리의 다른 글

ClinVar DB 를 통한 질병 연관 변이 찾기  (0) 2017.09.09
CIGAR Format  (0) 2017.08.13
Lastz 실행  (0) 2017.08.13
Lastz 설치 및 테스트  (0) 2017.08.07
Platypus 를 통한 variant calling  (0) 2017.08.07
bam 파일 인덱싱  (0) 2017.08.07