Domains (49)

유전자 발현


인간의 DNA 속 기능의 단위인 유전자는 단백질을 암호화하고 있고, 유전자가 암호화하고 있는 단백질은 세포의 기능을 결정합니다. 따라서 어떤 세포 안에서 생성되는 수천개의 유전자는 그 세포가 무엇을 할지를 결정합니다. 각각의 세포는 다른 유전자를 생성함으로써 다른 기능을 수행하는 것입니다. 유전자 발현이란 이렇게 DNA가 최종 생산물인 단백질(혹은 ncRNA)을 생성하는 과정을 뜻합니다. 그리고 유전자 발현은 각각의 세포마다 다르게 일어납니다. 예를 들어, 시세포, 지방세포, 뇌세포 등은 각각 다른 단백질을 생성함으로써 원하는 생물학적 기능을 수행하게 됩니다. Central Dogma라고 불리는 DNA가 전사 되어 RNA가 되고 RNA가 번역되어 단백질이 되는 각각의 단계는 생성되는 단백질의 종류와 양을 조절할 수 있는 조절 포인트입니다.


어떻게 유전자 발현이 조절될까?


이처럼 유전자가 단백질이 되어가는 과정 속에서 유전자의 발현을 조절하여 유전자의 산물(전사체 혹은 단백질)의 양을 조절하는 것을 유전자 조절(gene regulation)이라고 합니다. 세포 내에서의 각 유전자들의 발현량 그 세포의 기능을 결정합니다. 유전자 조절은 여러 단계가 있지만, 그 중 전사 조절이 가장 중요하고 대부분의 유전자 조절이 일어나는 단계입니다. 사실 진핵 생물의 유전자 발현 조절은 매우 복잡합니다. 진핵생물에서는 전사체가 핵을 떠나기 전에 변형이 일어납니다. 단백질을 코딩하지 않는 부분인 "인트론"이 사라지며, 단백질을 코딩하는 부분인 "엑손" 만 남게 됩니다. 이 엑손이 서로 붙게되어 mature mRNA가 생성됩니다. 또 양 끝부분에도 변형이 일어나는데 이는 안정성에 영향을 끼칩니다. 이러한 RNA Processing의 과정 속에서도 유전자 조절이 일어날 수 있습니다. 또는 번역 단계에서도 miRNA 등의 small RNA에 의해 유전자 조절이 이루어지기도 합니다. 


A schematic of a eukaryotic cell and its interior shows the transcription of DNA to RNA, and the translation of RNA to protein in four steps: transcription, RNA splicing, nuclear export, and translation. Each step is represented by a labeled arrow. Transcription of a DNA template to a pre-mRNA and the splicing of the pre-mRNA into a mature mRNA are shown inside the cell nucleus. The nuclear export brings the mature mRNA to the cytoplasm, where the mature mRNA message is translated into a protein.Figure 1: 진핵생물에서 DNA가 단백질이 되어가는 과정

DNA의 번역, 비번역 부위가 mRNA로 전사된다. mRNA 프로세싱 도중 인트론 부분이 제거된다. 엑손 부분만 남아서 연결되며, 양 끝에 특별한 시퀀스가 붙는다. 이러한 프로세싱이 완료되면 mRNA는 핵을 빠져나가 세포질로 가게된다. 일단 세포질로 가게되면 mRNA는 단백질을 생성할 준비가 완료된다.

어떻게 세포는 자신들이 필요한 유전자를 발현 시킬까?


위에서는 유전자가 단백질로 변화하는 과정 속에서 유전자 조절이 언제 이루어지는지 알아보았습니다. 그렇다면 구체적으로 어떻게 세포는 원하는 유전자만 발현시켜 원하는 기능을 수행할 수 있을까요? 이는 각각의 세포들이 제각기 다른 전사 조절 인자들을 갖고 있기 때문입니다. 이러한 조절 인자들은 전사를 촉진(activate)시키기도 하고 방해(repress)하기도 합니다. 전사 조절 인자는 단백질이며, 이 전사조절인자도 유전자들이 코딩하고 있습니다.


일반적으로 전사는 RNA 중합효소가 소위말하는 프로모터 시퀀스에 결합함으로써 시작됩니다. 이 시퀀스는 전사 시작 지점에 근접한 upstream 방향에 존재합니다. (5' 쪽 방향) 하지만 downstream 방향에도 존재할 수 있습니다. (3' 쪽 방향) 비교적 최근에 연구자들은 인핸서 시퀀스라는 것을 발견하였습니다. 인핸서전사 조절 단백질들이 결합할 수 있는 결합 위치(binding site)를 제공함으로써 전사에서 중요한 역할을 하는 시퀀스입니다. 이 인핸서의 전사 조절 단백질이 붙게되면 염색질 구조가 변화되어 RNA 중합효소나 조절 단백질의 결합을 촉진하거나 억제하는 역할을 하게됩니다. 이 때 염색질 구조를 open chromatin structure라고 하는데, 이는 유전자 전사가 활성화 된다는 것과 연관이 있습니다. 반면 염색질의 구조가 빽빽한 경우, 전사가 억제되어 있는 것과 연관이 있습니다.


몇몇 조절 단백질은 다양한 유전자의 전사에 영향을 미칩니다. 이는 전사 조절 단백질 결합 위치 (regulatory protein binding site 혹은 transcription factor binding site라고도 함)가 다양한 곳에 존재하기 때문입니다. 결과적으로 조절 단백질은 다양한 유전자의 걸쳐 다양한 역할을 합니다. 조절 단백질의 역할은 단지 어떤 한 유전자의 발현을 조절하는 것이 아니라 다양한 유전자의 발현을 조절합니다. 이것이 각각의 세포가 한 번에 많은 수의 유전자를 조절할 수 있는 하나의 메커니즘입니다.



A two-part schematic shows how an activator protein binds DNA to initiate transcription. A linear DNA molecule is shown above a DNA molecule folded to form a loop. The enhancer sequence, promoter sequence, and site of transcription are represented by colored shading on both DNA molecules, and an activator molecule is represented by a globular structure. The interaction between RNA polymerase, a mediator protein, and the activator protein are shown in the bottom illustration.
Figure 2: 전사의 조절
활성 단백질이 인핸서 시퀀스에 결합하게되면 RNA 중합효소를 활성화 시키는 프로모터 부분에 단백질을 끌어들일 수 있고, 이로 인해 전사가 촉진된다. DNA는 위와 같이 굽어져 활성자 단백질은 RNA 중합효소의 활동을 중재하는 다른 단백질들과의 상호작용을 하게 된다.


우선 원핵 세포에 대해서 알아보면, 원핵생물에서 조절 단백질은 종종 영양소의 이용가능성에 의해 조절됩니다. 이는 박테리아와 같은 생물이 환경 조건에 반응하여 전사 패턴을 빠르게 조절할 수 있게 합니다. 덧붙여, 원핵생물의 조절 부위는 프로모터와 가깝게 위치합니다.

A three-part schematic shows how a repressor protein can inhibit transcription by preventing RNA polymerase from binding DNA. Part 1 shows the layout of a linear region of DNA. The operator is represented by colored shading on the DNA molecule and spans three nucleotides. The site of transcription is shaded a different color, and an arrow points from left to right above the shading to show the direction transcription proceeds. Part 2 shows the positions of an inactive repressor protein and RNA polymerase relative to a DNA molecule when transcription is occurring. Part 3 shows the positions of an active repressor protein and RNA polymerase in relation to a DNA molecule when transcription is repressed.
Figure 3: 프로모터 주위에서의 전사 조절
특정 단백질은 RNA 중합효소에 간섭을 함으로써 전사를 조절한다. 불활성화 상태로 존재하는 억제 단백질(repressor)은 다른 분자에의해 활성화 될 수 있으며, 활성화된 상탱서 operator라 불리는 부위에 결합하여 RNA 중합효소가 프로모터에 결합하는 것을 방해한다. RNA 중합효소가 프로모터 부위에 결합하여야 전사가 개시됨으로 이는 전사를 효과적으로 억제한다. 

활성자(activator)는 프로모터 주위에 조절 부위에 결합하여 RNA 중합효소의 활동을 촉진합니다. 억제자(repressor)는 조절부위에 결합하여 RNA 중합효소의 결합을 방해합니다. 


진핵생물의 유전자 발현 조절은 원핵생물에 비해 복잡합니다. 위에서 기술한 것과 마찬가지로 기본적으로는 프로모터 주위 조절 부위에 결합하는 활성자, 억제자에 의해 RNA 중합효소의 활동량이 조절되어, 전사 과정에서의 유전자 조절이 일어납니다. 하지만 진핵생물에서는 그 이상의 많은 수의 조절 단백질이 존재하며, 조절 단백질의 결합 부위는 프로머터와 멀리 떨어져 있는 경우도 많습니다. 이로 인해 유전자 발현의 조절이 더욱 유연하게 됩니다.


A schematic shows three transcriptional regulator proteins on a DNA molecule. The DNA molecule is folded in on itself to form loops and each regulator protein is bound to the apex of a DNA loop and interacting with a single mediator protein bound to RNA polymerase. RNA polymerase is in turn bound to a region of DNA between the promoter sequence and the site of transcription.
Figure 4: 많은 수의 전사 조절 인자
전사 조절 인자들은 각각 다른 역할을 갖고 있다. 위의 3가지 전사 조절인자는 Mediator 복합 단백질과 각각 다르게 상호작용하여 전사를 조절한다. 각각의 조절단백질이 있고 없음, 또한 이들이 어떻게 조합되느냐에 따라 유전자의 발현이 달라진다. 진핵 생물의 유전자 발현의 특징은 이러한 복합한 조절 과정을 통해 같은 유전자라도 다르게 번역될 수 있다는 것이다.


다른 세포 유형은 특징적인 전사 조절인자를 갖고 있습니다. 다세포 생물에서 다른 세포는 각각 다른 조절 인자들의 조합을 갖고 있습니다. 이로인해 각기 다른 기능을 하는 다양한 세포가 생성되고, 기능할 수 있는 것입니다.



A pedigree diagram shows how transcription factors influence the identities of four generations of cells. A single cell containing a nucleus is shown dividing to form two new cells (a second generation). Each of the two second-generation cells then divides to form two new cells, so this third generation has four cells. Each of the four third generation cells then divides to form two cells, for a total of eight fourth generation cells. The variable expression of transcription factors in each generation of cells is represented by the presence or absence of red, green, and yellow colored circles in their cytosol.
Figure 5: 전사 조절인자가 세포 유형을 결정한다.
세포 발달 과정에 따라 전사 조절 인자가 달라지는 것을 나타내는 그림
세포 유형의 다양성은 다른 전사조절인자들의 활동에 의한 것이다.

생명 활동을 위해서 세포는 환경의 변화에 반응해야합니다. 단백질 생산 과정의 중요한 두 가지의 스텝 (전사와 번역)에서의 유전자 조절이 이러한 환경 적응성에 중요한 역할을 합니다. 세포는 필요한 특정 유전자를 발현시켜, 세포의 기능을 수행하며, 또한 환경에 반응하는 유전자 조절을 통해 어떤 유전자가 전사되며 번역될지를 조절합니다.


참고 : Nature Education Gene expression

  • 섹스 2021.06.04 10:00

    굿

  • 공부중 2021.09.29 01:10

    너무 잘 설명해주시는 것 같아요!!

Chip-seq 데이터를 통한 binding motif의 분석


Chip-seq 을 통해 대략적인 protein binding site (혹은 histon modification)의 시퀀스를 알고, 이 시퀀스들 중에서 비슷한 시퀀스를 찾아내어 해당 protein에 specific한 시퀀스가 무엇인지를 알아내는 분석이다. 이를 수행하는 bioinformatics Tool은 매우 많으며, [Evaluating tools for transcription factor binding site prediction] 논문에서 좋은 평가를 받았던 rGADEM을 이용하여 binding motif를 찾는 분석을 해보도록 한다. rGADEM은 GADEM 방법을 r로 구현한 것이며, GADEM은 motif를 찾는데 Genetic 알고리즘과 EM 알고리즘을 결합하여 사용한다. 자세한 방법론은 본 포스팅에서 다루지 않는다. 본 포스팅은 이 튜토리얼을 참고하였다.

# rGADEM Tutorial # reference : https://bioconductor.org/packages/devel/bioc/vignettes/rGADEM/inst/doc/rGADEM.pdf source("https://bioconductor.org/biocLite.R") # biocLite("rGADEM", lib="C:/Users/Documents/R/win-library/3.4") # biocLite("BSgenome.Hsapiens.UCSC.hg19", lib="C:/Users/Documents/R/win-library/3.4") # biocLite("DNAStringSet", lib="C:/Users/R/win-library/3.4") # install.packages("RCurl") library(RCurl) library(rGADEM) library(BSgenome.Hsapiens.UCSC.hg19)

rGADEM은 bioLite 패키지에 있으며, 위와 같이 설치할 수 있다. rGADEM, BSgenome..., DNAStringSet 3개의 bioLite 패키지를 설치한 후, 이와 의존성이 있는 RCurl 패키지까지 설치하면 라이브러리 로드가 완료된다.


데이터


Test_100.bed

Test_100.fasta


rGADEM을 설치하면 위 예제 데이터가 패키지 안에 기본으로 들어있다. 이 예제 데이터를 통해 실습을 해보도록 한다.


chipseq 데이터로 binding motif를 분석하기까지의 pipeline은 QC, peak calling 등의 과정을 거쳐야한다. 하지만 이번 분석에서는 peak calling까지 끝난 데이터로 분석을 한다고 가정한다. peak calling이 완료되면 protein binding이 많이 일어난 부분의 시퀀스를 얻어낼 수 있다. 이 데이터는 주로 BED 혹은 FASTA 파일로 주어진다.


1. 데이터가 BED 포맷인 경우

BED <- read.table("C:\\Test_100.bed",header=FALSE,sep="\t") BED <- data.frame(chr=as.factor(BED[,1]),start=as.numeric(BED[,2]),end=as.numeric(BED[,3])) BED rgBED <-IRanges(start=BED[,2],end=BED[,3]) Sequences <- RangedData(rgBED,space=BED[,1]) rgBED Sequences


> BED


chr start end 1 chr1 145550911 145551112 2 chr1 112321064 112321265 3 chr1 120124183 120124384 4 chr1 114560780 114560981 5 chr1 8044002 8044203 6 chr1 154708057 154708258 7 chr1 21537833 21538034 8 chr1 117197889 117198090 9 chr1 22547577 22547778 10 chr1 170982215 170982416 11 chr1 203938925 203939126 12 chr1 198607893 198608094 13 chr1 244838696 244838897 14 chr1 22613354 22613555 15 chr1 36725231 36725432 50 chr1 35024860 35025061

> rgBED
IRanges object with 50 ranges and 0 metadata columns:
           start       end     width
       <integer> <integer> <integer>
   [1] 145550911 145551112       202
   [2] 112321064 112321265       202
   [3] 120124183 120124384       202
   [4] 114560780 114560981       202
   [5]   8044002   8044203       202
   ...       ...       ...       ...
  [46]  24574361  24574562       202
  [47]  46110458  46110659       202
  [48] 114377432 114377633       202
  [49] 152657429 152657630       202
  [50]  35024860  35025061       202


> Sequences
RangedData with 50 rows and 0 value columns across 1 space
       space                 ranges   |
    <factor>              <IRanges>   |
1       chr1 [145550911, 145551112]   |
2       chr1 [112321064, 112321265]   |
3       chr1 [120124183, 120124384]   |
4       chr1 [114560780, 114560981]   |
5       chr1 [  8044002,   8044203]   |
6       chr1 [154708057, 154708258]   |
7       chr1 [ 21537833,  21538034]   |
8       chr1 [117197889, 117198090]   |
9       chr1 [ 22547577,  22547778]   |
...      ...                    ... ...
42      chr1 [221975293, 221975494]   |
43      chr1 [ 59123669,  59123870]   |
44      chr1 [ 76297843,  76298044]   |
45      chr1 [188010599, 188010800]   |
46      chr1 [ 24574361,  24574562]   |
47      chr1 [ 46110458,  46110659]   |
48      chr1 [114377432, 114377633]   |
49      chr1 [152657429, 152657630]   |
50      chr1 [ 35024860,  35025061]   |


2. GADEM 실행

gadem <- rGADEM::GADEM(Sequences,verbose=1,genome=Hsapiens)

interation을 돌며 GADEM 알고리즘이 실행된다.


총 2개의 motif 가 생성되었다.

> length(gadem@motifList)
[1] 2



이 중에서 첫 번째 motif는 아래와 같이 생겼다.

plot(gadem@motifList[[1]])



> gadem@motifList[[1]]@alignList
[[1]]
An object of class "align"
Slot "seq":
[1] "GCCCCGACCTCTTATCTCTG"

Slot "chr":
[1] "chr1"

Slot "start":
[1] 43552181

Slot "end":
[1] 43552382

Slot "strand":
[1] "+"

Slot "seqID":
[1] 38

Slot "pos":
[1] 100

Slot "pval":
[1] 2.209965e-09

Slot "fastaHeader":
[1] 38


[[2]]
An object of class "align"
Slot "seq":
[1] "ACCCCAACCTCTTATCTCTG"

Slot "chr":
[1] "chr1"

Slot "start":
[1] 43552181

Slot "end":
[1] 43552382

Slot "strand":
[1] "+"

Slot "seqID":
[1] 38

Slot "pos":
[1] 58

Slot "pval":
[1] 2.365196e-09

Slot "fastaHeader":
[1] 38


[[3]]
An object of class "align"
Slot "seq":
[1] "ACCCCAACCCCTTATTTCTG"

Slot "chr":
[1] "chr1"

Slot "start":
[1] 43552181

Slot "end":
[1] 43552382

Slot "strand":
[1] "+"

Slot "seqID":
[1] 38

Slot "pos":
[1] 121

Slot "pval":
[1] 5.472386e-09

Slot "fastaHeader":
[1] 38

GADEM 알고리즘은 이 motif를 설명할 수 있는 총 26개의 시퀀스를 찾았다. 이 중 3개의 시퀀스가

GCCCCGACCTCTTATCTCTG
ACCCCAACCTCTTATCTCTG
ACCCCAACCCCTTATTTCTG

이다. 이러한 비슷한 시퀀스를 tfbs 라고 하며, tf protein이 이 곳에 달라붙어 regulatory role을 수행하게 된다.

[[26]]
An object of class "align"
Slot "seq":
[1] "CCTTCCTTCCTTTCTTCCTT"

Slot "chr":
[1] "chr1"

Slot "start":
[1] 200254533

Slot "end":
[1] 200254734

Slot "strand":
[1] "-"

Slot "seqID":
[1] 36

Slot "pos":
[1] 193

Slot "pval":
[1] 0.0001878598

Slot "fastaHeader":
[1] 36


위 결과처럼 - strand의 결과도 볼 수 있는데, 이 경우에는 BED파일에서 reverse strand를 보면 된다. 하지만 위 결과는 자동으로 reverse strand를 보여준다. http://genome.ucsc.edu/cgi-bin/das/hg19/dna?segment=chr1:200254533,200254734를 확인하면 위 시퀀스의 reverse인 aaggaagaaaggaaggaagg 를 확인할 수 있다.



3. INPUT이 FASTA 파일인 경우

# 2. Input이 FASTA 파일일 경우
path <- system.file("extdata/Test_100.fasta", package="rGADEM")
FastaFile <- paste(path,sep="")
Sequences <- readDNAStringSet(FastaFile, "fasta")
Sequences

Fasta파일의 경우 위와 같이 전처리 하면 되며, 이후의 절차는 BED 파일과 동일하다.

> Sequences
  A DNAStringSet instance of length 49
     width seq                                                                                                      names               
 [1]   202 CTACAGCTGTTCCTTGTCATCAGCCTGGGGGTGGGTAGTATTTTGATCTTA...GTCCCCATGTGACTGTAGGGTTCCTGAAACCTGGCAGGCCACTCTGCTTG FOXA1 _ 1
 [2]   202 TTATTCTGATGTGGTTTTGCGGTTATACAGTAAGCAGCACTGCTTATGTGG...ACACCAGAGGCCACCAGGACCAGAATGTTTACCAATGTAGGCAGTCACTA FOXA1 _ 10
 [3]   202 AAAGGAGAAACACAGCCAAATAATAAAACAATATCTTCTGTAAGTAAAGAG...CAAAGGTGCAAAGCCCTCTTTCAGATCCATCTCCACCATTTCCCTTCAGG FOXA1 _ 11
 [4]   202 TGTACCCCCCCAATATTTCATGATATTTACATGTTTGCATAGTACTTTCCT...CACAGGCAGAGTCAACATTGGAACTCGGAACACTGAGCCTGGCATTCCAA FOXA1 _ 12
 [5]   202 TTTAAGACTGCCACCTGAAATCAAGTCCAGTGGCTGTTCCTGTCTTCCCGT...TTATTTAACCTTTTGCCATTAGTTTACAAGAAGACGGGTTGAGCGAGTCA FOXA1 _ 13
 ...   ... ...
[45]   202 ATTAGTTCATGCCAGGCAGGGTTTGACCAAAACCTTGGACTCACTCCTGTC...TGCTGCTGCTAAGCCAGTGAGATAGATGGTGGTTTGGAAACACCCTCATG FOXA1 _ 5
[46]   202 CCAGAGCCACCACAGCCAGGCCTCTGCGGCCAGTGTCAACAAGGGGCCAGG...TGGGGTTTTGTTTACACACCTAGGGTCACCTGAAAACACCTGCTGTTTAA FOXA1 _ 6
[47]   202 CAGATCAGAGCCTGGGAGCGGGCCATGTGCAGCTGGATGGGCAGCTGGAGG...GCCCACCCTCCTGCCTTCCCAGCCAAGGAGGGAAGGGAGCTGTGGGAGGA FOXA1 _ 7
[48]   202 GGAATGTGATTTACCCAGATAAATCATCAGCTCAAGGGACTGCTTGGAGAG...TCCAGAGCTAGACGCAGAGGAAGGGGTCAAACATGTCCACATGGAACCTG FOXA1 _ 8
[49]   202 GGCTTTTCCAAGAACAATAGTGTTCTCCTAACAAACATTCGTTCCATCAGC...GGTGTTAGGGACAGAGTCCCAGGTGGCATAAAGTCGGGTTGGTCCTTGGC FOXA1 _ 9

예제 Fasta 파일의 경우 아래와 같은 motif를 찾았고, 총 74개의 sequence가 이 consensus에 부합했다. 즉, FOXA1라는 transcription factor의 binding motif (혹은 transcription factor binding site)의 consensus를 위의 Fasta 파일의 데이터를 통해 예측해볼 수 있다.

plot(gadem@motifList[[1]])



[[72]] An object of class "align" Slot "seq": [1] "CTATTGACTTT" Slot "chr": [1] "chr" Slot "start": [1] 0 Slot "end": [1] 0 Slot "strand": [1] "-" Slot "seqID": [1] 4 Slot "pos": [1] 93 Slot "pval": [1] 0.0001517677 Slot "fastaHeader": [1] 4 [[73]] An object of class "align" Slot "seq": [1] "ATATTTACTTG" Slot "chr": [1] "chr" Slot "start": [1] 0 Slot "end": [1] 0 Slot "strand": [1] "+" Slot "seqID": [1] 42 Slot "pos": [1] 135 Slot "pval": [1] 0.0001719873 Slot "fastaHeader": [1] 42 [[74]] An object of class "align" Slot "seq": [1] "CTATTTGCTGG" Slot "chr": [1] "chr" Slot "start": [1] 0 Slot "end": [1] 0 Slot "strand": [1] "+" Slot "seqID": [1] 41 Slot "pos": [1] 53 Slot "pval": [1] 0.0001754087 Slot "fastaHeader": [1] 41


'Domains > Bioinformatics' 카테고리의 다른 글

Samtools, Bcftools 설치 방법  (0) 2018.05.14
GATK4 설치  (0) 2018.02.20
Chip-seq 데이터를 통한 binding motif 분석 [rGADEM]  (0) 2018.01.13
Variant calling 이란?  (0) 2017.11.20
IGV Tutorial [BAM File]  (0) 2017.10.16
Sam File  (0) 2017.10.16


Gene 구성요소의 5가지 분류


1. Exon

- 폴리펩타이드를 코딩하는 DNA 서열이다.


2. Intron

- 단백질을 코딩하지 않는 DNA 서열이다. * 하지만 miRNA 등의 non-coding RNA를 코딩할 수 있는 것으로 보인다.


3. Transcription Start Site

- RNA 중합효소2(polymerase)가 붙어서 전사가 시작되는 위치이다. (RNA 중합효소2는 12개의 단백질의 중합체로 mRNA를 합성해내는 물질이다.)


4. Promoter

- Core Promoter : TATA 박스(타타 박스라고 읽음)라는 것이 있는데, 이 곳은 실제로 Transcription Factor와 기타 여러 Regulatory Protein이 실제로 붙는 곳이다. 이를 통해 50여개의 단백질 complex가 만들어지며, 이것이 실제로 trascription이 일어나는데 필요한 물질들이다.

- Upstream Promoter : transcription factor 와 기타 조절 단백질(regulatory protein)이 달라붙는 부분이다. Upstream promoter는 gene마다 갯수와 타입이 다르다. transcription factor는 붙어서 해당 유전자를 활성화하거나 비활성화한다.


Promoter는 gene expression을 "총괄" 한다고 보면 되며, 이를 Enhancer가 돕는다고 볼 수 있다. 참고로 잘 알려지지 않은 것 중에 Silencer 라는 것도 있다. 이는 Histon modification과 같은 방식으로 Promoter의 반대 기능 gene expression을 억제하는기능을 수행한다.


5. Enhancer

- 보통 upstream 또는 downstream 방향으로 수천 bp 떨어진 곳에 위치하며, (또는 gene 안에 존재할 수도 있다.) transcription factor가 달라붙게 되면 promoter 쪽으로 굽어서 유전자 발현을 조절한다. 예를 들어, promoter에게 "여기는 brain이니까 이 gene을 더 발현해라!" 라고 말하는 것으로 보면 된다.


유전체에서 유전자 발현 조절 과정 (Regulation)을 수행하는 요소를 찾는 것은 중요한데, 이러한 유전체상의 조절부위(Regulatory region)을 찾는 기본적인 원리는 이 부위에 transcription factor가 달라붙는다는 성질을 이용하여 antibody를 이용한 assay를 하는 것이다.


참고그림 - 출처 위키피디아



한국어 설명 자료

https://blog.naver.com/david6703/220973718228


Gene Regulation 관련 읽어보면 좋을 글

http://genetics.thetech.org/original_news/news14

https://www.nature.com/scitable/topicpage/gene-expression-14121669

https://www.khanacademy.org/science/biology/gene-regulation/gene-regulation-in-eukaryotes/a/overview-of-eukaryotic-gene-regulation

GWAS, QTL, Linkage study 셋의 차이점


Linkage mapping/recombination mapping/positional cloning - rely on known markers (typically SNPs) that are close to the gene responsible for a disease or trait to segregate with that marker within a family. Works great for high-penetrance, single gene traits and diseases.


QTL mapping/interval mapping - for quantitative traits like height that are polygenic. Same as linkage mapping except the phenotype is continuous and the markers are put into a scoring scheme to measure their contribution - i.e. "marker effects" or "allelic contribution". Big in agriculture.


GWAS/linkage disequilibrium mapping - score thousands of SNPs at once from a population of unrelated individuals. Measure association with a disease or trait with the presumption that some markers are in LD with, or actually are, causative SNPs.


So linkage mapping and QTL mapping are similar in that they rely on Mendelian inheritance to isolate loci. QTL mapping and GWAS are similar in that they typically measure association in terms of log-odds along a genetic or physical map and do not assume one gene or locus is responsible. And finally, linkage mapping and GWAS are both concerned with categorical traits and diseases.


Linkage Study : 가족데이터 - 멘델 유전 이용, 알려진 마커로 high-penetrance, single gene disease 멘델리안 질병에 대해서 연구

QTL : 가족데이터 - 멘델 유전 이용, polygenic & quantitative trait (ex. height)

GWAS : 인구집단 데이터 - LD를 이용, polygenic, categorical trait 둘다


출처

https://www.biostars.org/p/47725/

 

Variant Calling


정의


variant call 은 어떤 개인의 genome혹은 transcriptome에서 reference와 뉴클레오타이드 서열의 차이가 있는지를 결정하는 것이다. 이 과정은 variant frequency와 confidence measure가 고려된다.


유즈케이스

 

DNA-seq : variants

  • 질병과의 유전적 연관성
  • 암에서의 돌연변이 알아내기
  • 이형접한 인구 빈도 알아내기

RNA-seq : allele-speicifc expression

  • Allelic imbalance
  • Association with isoform usage (splicing QTLs)
  • RNA editing (allele absent from genome)


Chip-seq : allele-specific binding

  • protein binding이 allele-specific하게 일어나는 현상


핵심은 variant call을 통해 어떤 locus에 'variant가 있다' 라는 정보를 알 수 있기 때문에 이를 통해 위와 같은 연구를 할 수 있음


Variant Call은 Genotype 보다 더 일반적인 접근이다.


genotype은 어떤 locus의 allele의 집합을 나타낸다. 근데 배수성을 보통 2n으로 가정하고 한다.  또한 genotype은 주로 SNP에 대해서만 고려된다. 하지만 RNA-seq 같은 경우 2n이 아니며 genotype이 없다. 또 암유전체학 등에서는 copy number variation이 중요하기 때문에 variantl call이 genotype보다 일반적인 접근법이라 할 수 있다.


 


 


참고

https://www.bioconductor.org/help/course-materials/2014/CSAMA2014/3_Wednesday/lectures/VariantCallingLecture.pdf

 

파일첨부

VariantCallingLecture.pdf

 


참고할 사이트들


Best Practices workflow

https://software.broadinstitute.org/gatk/best-practices/bp_3step.php?case=GermShortWGS

'Domains > Bioinformatics' 카테고리의 다른 글

GATK4 설치  (0) 2018.02.20
Chip-seq 데이터를 통한 binding motif 분석 [rGADEM]  (0) 2018.01.13
Variant calling 이란?  (0) 2017.11.20
IGV Tutorial [BAM File]  (0) 2017.10.16
Sam File  (0) 2017.10.16
K-MERS 란  (2) 2017.10.12

Allele and Genotype Frequency


하디 바인베르크의 법칙


특정 조건 안에서 allele frequency와 genotype frequency는 영속적으로 보존된다.

위 그림과 같이 allele frequency가 freq(A) = p, freq(a) = q일 때, 다음 세대의 genotype frequency의 기댓값은 freq(AA) = p^2, freq(Aa)=2pq, freq(aa)=q^2 이다. 이 genotype frequency를 통해 다시 allele frequency를 계산하면 freq(A)=p, freq(a)=q가 나온다. 즉, allele frequency와 genotyep frequency는 계속해서 유지된다.



allele frequency와 genotype frequency에서 중요한점


1. genotype frequency를 알면 allele frequency를 알 수 있다.

2. allele frequency를 알아도 genotype frequency를 반드시 알 수는 없다.


2번의 경우 예를 들어, freq(A) = 0.5, freq(a) =0.5 라하자. 그러면 하디 바인베르크 법칙을 만족하면 genotype frequency는 freq(AA)=0.25, freq(Aa)=0.5, freq(aa)=0.25일 것이다 하지만 freq(AA)=0.5, freq(Aa)=0, freq(aa)=0.5 여도 주어진 조건에 맞는다. 따라서 allele frequency를 알아도 genotype frequency를 반드시 알 수 있는 것은 아니다.allele frequency는 재료이다. 그것이 어떻게 조합되어 genotype을 구성할지는 확정적이지 않다. 이는 하디 바인베르크 법칙에 위배된다.


그렇다면 하디 바인베르크 법칙은 언제 만족하는가?


1. random mating

: 위에서 언급한 allele frequency를 알아도 genotype frequency를 반드시 알 수 없다. 하지만 random mating이라면 genotype frequency의기댓값은 하디 바인 베르크에서의 값과 같다.


2. no mutation, selection, migration

: 모집단의 임의적 변화가 없어야한다.


3. 무한한 모집단 사이즈

: genetic drift가 없어야 한다.


하디 바인베르크는 위 가정들을 만족할 수 없다. 그렇다면 하디 바인베르크 법칙은 왜 필요할까? 하디 바인베르크 법칙이 중요한 이유는 그것이 귀무가설(Null hypothesis)이 될 수 있기 때문이다. 하디 바인베르크 법칙을 귀무가설로 놓고 진화적 과정이 어떻게 일어나는지를 살펴볼 수 있다.


하디 바인베르크 법칙이 깨지는 상황


하디 바인베르크 법칙은 어떠한 집단 내에서 random mating이 일어나지 않을 때이다. 즉, 인종이 섞인 집단을 하나의 집단으로 놓았을 때, 하디 바인베르크 법칙이 깨지게 된다. 예를 들어, 한국인, 중국인이 각각 하디 바인베르크 법칙을 만족하더라도, 한국인, 중국인을 합쳐서 하나의 집단을 만들고 이 집단에 대해 하디 바인베르크 법칙을 만족하는지 테스트하면 하디 바인베르크 법칙을 만족하지 않는 결과가 나올 수도 있다.


wahlund effect


인종을 합쳤을때 heterozygous genotype이 하디-바인베르크 법칙으로 구한 hetero genotype의 기댓값보다 적게 나타나는 현상.


하디 바인베르크의 법칙이 중요한 이유는 GWAS를 할 때, 연구집단이 하디-바인베르크 법칙을 만족한다는 것을 가정하기 때문이다. 하디-바인베르크 법칙이 만족되지 않으면 GWAS의 결과가 부정확할 수 있다.


예를 들어, 인종1과 인종2의 SNP의 allele frequency가 다르고, 인종1의 유병률이 인종2의 유병률보다 높다고 하자. (유전적 원인이 아닌 환경적 원인에 의해 인종1의 유병률이 높다.) 그러면 인종1이 해당 마커에 많이 갖고있는 allele 근처의 gene이 질병에 영향을 준다는 잘못된 결론을 내릴 수 있다. 그러므로 이를 방지하기 위해 하디-바인베르르 법칙을 만족하는지 테스트를 해야한다. 연구집단에 대해 하디-바인베르크 법칙을 만족한다면 그 연구집단내에서 random mating이 이일어난다는 것을 알 수 있고, 그 연구집단이 하나의 인종을 이룰 수 있다는 것을 알 수 있기 때문에 다른 환경적 요인을 보정하여 bias를 방지할 수 있다. 



Gene vs Environment


어떠한 사람의 특성이 유전자로부터 비롯된 것인지, 환경으로부터 비롯된 것인지를 아는 것은 중요하다. 예를 들어, 만약 그 특성이 질병이라면 환경을 의식적으로 컨트롤함으로써 질병을 예방할 수 있다.


이러한 것을 확인하는 한가지 방법은 쌍둥이를 연구하는 것이다. 유전 vs 환경을 연구할 때, 유전, 환경 둘 중 하나를 고정시키고 다른쪽의 effect만 보면 보다 정확한 유전, 환경 효과를 파악할 수 있다. 쌍둥이 연구는 유전, 환경 중 하나를 고정하고 다른 요인의 효과를 파악하는데 적합하다.


유전적 요소 파악하기


쌍둥이를 통한 연구에서 보통 쌍둥이는 shared environment라고 가정한다. 이것이 쌍둥이 연구의 이점이다. 일란성 쌍둥이에서의 상관도(correlation)이 이란성 쌍둥이에 비해 높다면 그 특성은 유전적 요소가 환경적 요소에 비해 더 많이 개입할 것이라고 추론할 수 있다.


실제 예로 IQ의 경우 일란성 쌍둥이의 상관계수는 0.85, 이란성 쌍둥이의 상관계수는 0.42이다.


환경적 요소 파악하기


쌍둥이를 통한 연구에서 어떠한 특성의 환경적 요소를 파악하는 방법은 함께 살은 일란성 쌍둥이와 떨어져서 살은 일란성 쌍둥이를 비교하는 것이다. 함께살은 쌍둥이는 유전, 환경 모두 동일하지만, 떨어져 살은 쌍둥이는 유전, 환경 중에 유전만 동일하고 환경이 다르다. 따라서 함께 살은 쌍둥이의 상관계수가 더 높을수록 그 특성은 환경적 요소가 크게 작용한다고 생각할 수 있다.


보통 쌍둥이간의 상관계수는 같이 살은 일란성 > 떨어져 살은 일란성, 같이 살은 일란성 > 같이 살은 이란성 이 성립한다.


예를 들어서, 언어적 능력이라는 특성에 대하여 상관계수가 다음과 같이 나온 경우를 보자.


같이 살은 일란성(유전 같음, 환경 같음) : 0.76

떨어져 살은 일란성(유전 같음,환경 다름) : 0.51

같이 살은 이란성(유전 다름, 환경 같음) : 0.43


이 경우 0.76-0.51을 환경적 요소에 의한 특성의 차이로 볼 수 있고, 0.76-0.43을 유전적 요소에 의한 특성의 차이로 볼 수 있다.


유전, 환경 정량화하기


어떠한 정량화된 특성의 분산을 유전에 의한 분산과 환경에 의한 분산으로 나눌 수 있다.


simple formula : V = V(환경) + V(유전)


V는 분산을 구하는 공식으로 계산할 수 있는데, 어떻게 V(환경), V(유전)을 계산할 수 있을까? 방법은 생각보다 간단하다. V(환경)만 구하면, V(유전)도 구할 수 있고, V(환경)은 genotype을 고정시킨 후의 특성의 분산을 통해 구할 수 있다. 어떠한 특성에 관련있는 유전자가 6개라고 하자. 이 6개의 유전자에 대한 genotype이 모두 같은 sample안에서 분산을 구하면 이 분산은 오직 환경으로 인한 분산이다. 따라서 이 때의 분산 V1 = V(환경)이다. 이를 기존에 랜덤하게 뽑은 sample의 V에서 빼면 V(유전)을 구할 수 있다. 이 때 Heritability는 아래와 같이 정의된다.


Heritability = V(유전) / V(유전)+V(환경)


<모든 유전자가 heterozygous인 F1세대를 교배하여 만든 F2 세대를 통해 heritability 계산>


하지만 이런 방법을 사람에게 적용할 수는 없다. 실제로 사람에 대해 유전, 환경적 요소를 정량화하는 방법을 알아보자.



부모-자손 상관계수를 통해 Heritability 계산하기


실제 사람을 대상으로 heritability를 계산하는 방법 중 하나는, 부모-자손 상관계수를 이용하는 방법이다. 하지만 이 경우에 많은 한계점이 있다. 우선 첫 번째로, 부모-자손 상관계수를 이용하여 Heritability를 추정하는 경우 overestimated될 가능성이 있다. 부모-자손은 환경을 많은 부분 공유하기 때문이다. 우리가 보고 싶은건 유전적 요소 뿐인데 이러한 방법을 이용하게 되면 환경이 개입하여 heritability를 실제보다 더 높게 추정하게 된다. 또한 V(유전)을 알고 싶은 경우, 환경을 고정시킨 후 보아야하는데 환경을 고정시킬 수가 없다. 환경은 인구 집단에 따라 인종에 따라 다르다. 즉, V(환경)이 일정하지 않다. 그래서 연구 집단으로 어느 집단을 선택하냐에 따라 heritability 추정값이 달라진다. 


<키가 유전적 요소에 의해서만 좌우되는 경우>



<실제 키의 부모-자손 상관계수>




Breeder's Equation


인위 선택을 통해 Heritability를 계산할 수 있다. 옥수수 키의 평균이 5인치라고 하자. 이 방법에서는 7인치인 옥수수를 교배해서 나온 옥수수의 평균이 7인치라면 heritability = 1이다. 7인치 옥수수를 교배해서 나온 옥수수의 평균이 5인치면, 유전의 영향을 전혀받지 않는 것으로 heritability = 0이다. 만약 평균이 6인치가 나왔으면 1/2 = 0.5이다. 6.5인치면 1.5/2 = 0.75이다. 왜냐하면 7인치 옥수수를 뽑은 것은 모집단에서 뽑은 것이기 때문에 7-5=2 = V(유전)+V(환경)이다. 하지만 7인치를 교배해서 나온 6.5인치에서 평균을 뺀 6.5-5=1.5=V(유전) 이다. 따라서 이 둘의 비율로 heritability를 추정할 수 있다. 인위선택뿐 아니라 자연선택에서도 이 논리를 그대로 적용할 수 있다.




'Domains > Genetics' 카테고리의 다른 글

GWAS, QTL, Linkage study 셋의 차이점  (0) 2017.12.22
Genetics - Allele and Genotype Frequency  (0) 2017.11.14
Genetics - Gene vs Environment  (0) 2017.11.14
Genetics - Genome-wide association study  (0) 2017.11.13
Genetics - Genetic Mapping3  (0) 2017.11.12
Genetics - Genetic Mapping2  (0) 2017.11.11

GWAS의 원리


마커의 genotype 별로 질병의 비율을 본다. 이것이 임의로 생긴것인지 실제 질병에 연관이 있는건지를 검정한다. 그리고 이를 LOD plot과 같은 것으로 시각화 한다. 아래의 경우 A 마커주위의 LOD Score가 3 이상인(전통적으로 3이상이면 linkage가 있다고 본다. - https://en.wikipedia.org/wiki/Genetic_linkage) 지역에 위치한 gene이 질병과 연관이 있다고 볼 수 있는 후보가 된다.



Pedigree vs Population


Pedigree : family를 대상으로 양적표현형의 유전적 요소를 보는 것. 일반적으로 적은 gene에 대하여 연구하며 power가 크다. pedigree를 이용하는 경우는 recombination의 window가 크다. 그래서 많은 유전자를 mapping할 수 있다. 이것이 pedigree를 이용할 때의 장점이다.

Population : population을 대상으로 양적 표현형의 유전적 요소를 본다. 일반적으로 많은 수의 gene에 대하여 연구하며 power가 작을 수 있지만 많은 수의 연관 유전자를 찾을 수 있다.



왜 Population을 대상으로하면 power가 작을까?


1. pedigree를 통해 분석하면 popluation을 통해 분석했을 때보다 샘플의 유전적 근연도가 높다. 따라서 보고자하는 것 외에 다른 genotype은 비슷하게 고정시킬 수 있다.


2. popluation을 대상으로하면 rare variant를 테스트하기 힘들다. (샘플 수가 너무 작기 때문)



GWAS에 관한사실


1. GWAS는 common disease variant를 찾아내는데 잘 작동한다.

2. GWAS의 결과는 인종(ethnic group)별로 다를 수 있다.

 

 

GWAS의 간단한 예

 

 


'Domains > Genetics' 카테고리의 다른 글

Genetics - Allele and Genotype Frequency  (0) 2017.11.14
Genetics - Gene vs Environment  (0) 2017.11.14
Genetics - Genome-wide association study  (0) 2017.11.13
Genetics - Genetic Mapping3  (0) 2017.11.12
Genetics - Genetic Mapping2  (0) 2017.11.11
Genetics - Genetic Mapping1  (0) 2017.11.11
 

Single Gene 2 alleles Model의 결점


앞서 살펴본 것들은 Single Gene 2 alleles 모델이다. 이는 현실과는 다른데 그 이유로는 아래와 같은 것들을 들 수 있다.


1. Penetrance : 질병 유전자가 반드시 형질의 변화에 영향을 주지 않고 suceptability에 영향을 줌

2. 하나의 유전자가 아니라 많은 수의 유전자가 형질에 관여함

3. Epistatsis : 유전자들간의 상호작용

4. 한 유전자에 많은 allele이 있을 수 있음 (ex. 혈액형 - 3개의 alleles)

5. 형질에는 환경이 관여한다. : (선탠을 하면 피부가 탄다-environment effect, 어떤 사람은 선탠을 하면 피부가 더 잘탄다-genotype, environment interaction)


Mutation Rate


Mutation Rate는 mutation이 한 번의 generation에 얼마나 발생하는지를 나타내는 수치이다. muation rate는 mutation을 어떻게 정의하냐에 따라 달라지긴하지만 보통은 어떠한 하 나의 base가 다른 base로 변경되는 것을 mutation이라고 한다. C elegans를 대상으로 muation rate를 조사해봤을 때, 2.1*10^-8 / per base / per generation 이었다. 이를 인간에 적용해보면 3.1*10^9 * 2.1*10^-8 = 65개의 새로운 mutation이 평균적으로 매 generation 마다 생겨나는 것을 알 수 있다. 그리고 실제 인간을 대상으로 mutation rate를 연구를 한 논문에서도 63개 정도의 mutation이 generation마다 평균적으로 발생한다고 밝혀졌다. 그리고 새롭게 생기는 mutation의 수는 아버지의 나이와 관련 있다. 아버지의 나이가 많을 수록 더 많은 수의 mutation이 평균적으로 발생한다. 그 mutation들 중에서 평균적으로 1~2개의 mutation이 해롭다고 한다.




QTL


양적 형질에 관여하는 것으로 예상되는 loci를 QTL이라 한다. 실제로 그것의 정확한 위치는 알 수 없지만 마커와의 연관을 통해 근사적으로 추론한다. 특정 양적 형질에 영향을 미치는 많은 QTL이 많이 발견되었다.


genotype-phenotype의 관계를 추론하는데 사용하는 근본적인 방법은 phenotype에 영향을 미치는 gene 근처의 마커와 phenotype의 연관(association)을 보는 것이다. A라는 마커의 genotype을 AA, Aa, aa라고 하고, AA인 사람의 키의 평균이 180cm, Aa인 사람의 키의 평균이 175, aa인 사람의 키의 평균이 170cm였다면, A가 disease와 연관이 있다고 볼 수 있다. 그리고 실제 QTL은 A 마커와 연관이 되어 있다고 추론할 수 있다. A 마커와 실제 QTL에 recombination이 거의 없을수록 A 마커의 effect는 크게 나타날 것이다. 



이는 마치 누군가가 실종되었는데, 그 사람의 위치를 정확하게 말하지 않고 "노스캐롤라이나 주" 라고 말하는 것과 같다. 따라서 많은 마커를 통해 실제 QTL의 위치를 specific 하게 찾는 것이 중요하다.



Localizing QTL


이러한 LOD plot을 통해 QTL을 localization할 수 있다. 이 그림을 통해 토마토의 10번 염색체 위의 마커들이 ph와 연관 되었음을 확인할 수 있다. 단순형질과 다른 점은 이러한 연관된 region이 한 군데가 아니라 여러곳에 존재한다는 것이다.



하지만 위 그림을 보고 B, C 사이에 QTL이 존재할 것이라고 생각하는 건 위험할 수 있다.


바로 위와 같은 상황이 있을 수 있기 때문이다. B, C 사이에 T가 있고 T의 연관은 적을 수도 있다. 이 상황에서는 B, C 사이에 한 개의 QTL이 있는 게 아니라 B 근처에 한 개, C 근처에 한 개가 있다고 볼 수 있다.



출처 - 코세라 Duke University 유전학 강의


'Domains > Genetics' 카테고리의 다른 글

Genetics - Gene vs Environment  (0) 2017.11.14
Genetics - Genome-wide association study  (0) 2017.11.13
Genetics - Genetic Mapping3  (0) 2017.11.12
Genetics - Genetic Mapping2  (0) 2017.11.11
Genetics - Genetic Mapping1  (0) 2017.11.11
Genetics - Recombination  (0) 2017.11.11


Genetic Mapping2


유전자의 상대적 위치를 결정하고, 특정 질병과 관련있는 유전자를 특정하는 것 genetic mapping이라고 한다. Genetic mapping의 궁극적인 목표는 genotype과 phenotype의 association을 알아내는 것이다.


[genetic mapping의 개념]



Human Genom Project를 통해 인간 유전체 30억개 서열을 읽을 수 있게 되었고, 20000여개의 gene을 찾아내었다. 하지만 서열을 통해 gene이 무슨 역할을 하는지 어느정도 알 수있었지만, 어떤 변이가 disease-causing 인지는 "추측"할 수 밖에 없다.


수십년전부터 시작된 Gene Mapping은 disease-causing mutation이 어디인지 상대적으로 결정하는 것이다. gene mapping은 dna sequencing이 발달하기 이전의 최초 접근법이라고 볼 수 있다. 상대적으로 결정한다는 것은 genome 상에 어떤 reference point와의 상대적 위치를 결정한다는 것인데 이 reference point를 genetic marker라고 한다. genetic marker는 보통 SNP(single nucleotide polymorphism)을 사용한다.



다소 극단적인 예를 들어보자. A, B 라는 SNP marker가 있고, 위는 offspring의 genotype과 질병 여부를 나타낸 것이다. B marker의 genotype이 bb인 경우, 모두 질병에 걸렸으므로, B의 bb genotype이 질병과 연관(linked)이 있다는 것을 알 수 있다. 따라서 B marker가 실제 disease-causing mutation과 association이 있다고 추론해볼 수 있다.



Genetic Mapping Example


Gene Mapping을 하기 위해서는 parents와 offspring의 Marker의 genotype이 필요하다. 또 parents 중 한 명은 heterozygous여야한다. homozygous인 경우, recombination을 관찰할 수 없기 때문이다. 예를 들어서 genetic mapping을 실제로 하는 법을 살펴보자. 마커 AB에 대하여, AB/ab genotype과 ab/ab genotype인 부모의 자손을 조사했을 때 다음과 같은 genotype-phenotype 결과를 얻었다고 하자. Genetic Mapping의 목표는 disease-causing mutation의 A,B와 비교한 상대적인 위치를 알아내는 것이다.


위 경우에는 A marker가 disease와 연관이 있다는 것을 알 수 있다. C 유전자가 실제 disease-causing이라면, 이 C 유전자의 genotpe이 A와 같이 유전될 것이다.


그러면 C 유전자를 포함해 위와 같은 genotype-phenotype 관계를 알 수 있고, 이를 통해 gene map을 추론할 수 있다. 위 문제의 답은 A-C-B 이다. 가장 희귀한 case인 abC/abc, ABc/abc를 보면, A와 B 는 parental이고, C만 recombinant임을 알 수 있다. 빈도가 희귀한 것과, A-B는 parental인데, C만 recombinant 인 것을 보면 이는 A-C-B 에서 double recombination이 일어나, A-c-B, a-b-C가 되었음을 알 수 있다. 혹은 각각의 유전자들마다 recombination fraction을 구해서 gene map을 구할 수도 있다. 즉, A-B, B-C, A-C의 recombination fraction을 구한 후, 이를 통해 유전자의 상대적 위치를 알 수 있다. 예를 들어, A-B의 recombination fraction = 157/843+157 = 0.157


문제


AbC/aBc X abc/abc의 결과로 아래와 같은 빈도가 관찰되었다.


ABC/abc = 13

ABc/abc = 11

abC/abc =6

AbC/abc = 257

aBc/abc = 237

Abc/abc = 1

aBC/abc = 0

abc/abc = 8


A-C의 recombination fraction의 근사값은?


ABC/abc = 13 => parental

ABc/abc = 11 => recombinant

abC/abc =6=> recombinant

AbC/abc = 257=> parental

aBc/abc = 237 => parental

Abc/abc = 1=> recombinant

aBC/abc = 0 => recombinant

abc/abc = 8 => parental


11+6+1+0/13+11+6+257+237+1+0+8 = 0.033




Population Mapping


Genetic mapping은 앞서본것처럼 가족을 대상으로 할 수도 있지만, 인구 집단을 대상으로 할 수도 있다.



이 그림은 4개의 염색체가 시간이 오래지나서 뒤죽박죽 섞여 있는 모습을 나타낸 그림이다. (D=Disease Allele, M1=Marker1, M2=Marker2) 이 그림에서 중요한 사실은 아무리 많은 세대가 지나더라도 D와 M1사이의 연관은 그대로 남아있다는 것이다. 이렇게 연관이 그대로 남아있을 수 있는 이유중 하나로, Recombination이 완전히 임의로 일어나지 않는다는 사실을 들 수 있다. 염색체에서 Recombination이 자주 일어나는 부분을 Recombination hotspot이라 하는데(hot spot은 평균적으로 매 3000bp 마다 한 번씩 존재한다.) 이 부분을 제외한 나머지 부분은 recombination fraction이 거의 0에 가깝다. 따라서 hotspot과 hotspot 사이에 window가 형성되는데 이 window 내에서는 recombination이 거의 일어나지 않고 세대가 지나더라도 같이 유전된다. 이를 Linkage disequilibrium(LD)이라 한다. 어떠한 window 내에 disease gene이 있을 수 있고, 우리는 이러한 LD를 이용하여 disease gene을 찾을 수 있다. hot spot이 평균적으로 매 3000bp 마다 한 번씩 있으므로 30억/3000 = 100만개의 SNP을 마커로 사용한다면 disease gene을 찾을 수 있다.



이 그림은 window와 LD에 대해 이해하기 좋은 그림이다. 이를 통해 disease locus의 위치를 알아내기 위해 마커가 어떻게 쓰이는지를 이해할 수 있다. 예를 들어 SNP2=G일 때 Disease Allele인 A가 높은 비율로 존재한다. 따라서 SNP2은 Disease에 대해 연관이 있고 좋은 정보를 준다는 것을 알 수 있다. 하지만 윈도우 밖의 SNP5의 경우 disease와 아무런 연관이 없다.


위에서 말한 100만개의 SNP 마커를 (genotype) 알아내는 기술을 microarray라 한다. 많은 회사들이 이러한 SNP 마커를 이용해 disease suceptabilty를 알려주는 서비스를 제공한다.



Pedigree와 population으로 mapping하는 것의 차이는 위 그림에서 볼 수 있다. pedigree는 세대수가 적기 때문에 recombination이 된 부분이 적다. 따라서 같은 염색체 내에서 두 locus가 recombination이 되었을 확률이 적다. 하지만 Population의 경우 매우 많은 세대가 지난 것이기 때문에 같은 염색체 내에서라도 많은 recombination이 일어났을 것이다. 그러므로 recombination이 안일어났을 것이라고 보장되는 범위가 pedigree에서는 ~2백만bp이지만 population을 이용했을 때는 ~3000bp 정도이다. 또 Population을 대상으로하면 질병이 희귀한 경우 연구하기 힘들다. 엄청나게 많은 sample을 뽑아야하기 때문이다.





출처 - Coursera Duke Univ 유전학 강의


'Domains > Genetics' 카테고리의 다른 글

Genetics - Genome-wide association study  (0) 2017.11.13
Genetics - Genetic Mapping3  (0) 2017.11.12
Genetics - Genetic Mapping2  (0) 2017.11.11
Genetics - Genetic Mapping1  (0) 2017.11.11
Genetics - Recombination  (0) 2017.11.11
EM 알고리즘 haplotype frequency 추정  (0) 2017.10.08